Snímek 1 - Department of Molecular Biology

Snímek 1 - Department of Molecular Biology

KLONOVN a GENOV INENRSTV KLONOVN a GENOV INENRSTV 1) vodn pednka 2) PCR techniky 3) mutageneze in vitro 4) cDNA a genomov knihovny 5) sekvencovn genom 6) transgenoze rostlin 7) genov ipy 8) transgenoze ivoich 9) genov terapie 10) klonovac strategie a expresn systmy 11) semin nstroje molekulrn biologie v praxi Zskvn bioinformac (dobrovoln semin)

NCBI (National Center for Biological Information) TIGR (The Institute for Genomic Research) SignalP, TargetP (predikce bunn lokalizace protein) BIOEDIT (freeware pro manipulaci s DNA a proteiny) BLAST (basic local alighment and search tool) GENEVESTIGATOR (sledovn exprese gen na rovni celch genom in silico) LITERATURA Glick R a Pasternak JJ

Molecular Biotechnology 3th edition, ASM Press Ltd, Washington, USA, 2003 Sambrook J a kol. Molecular Cloning 1,2,3 3th edition, Cold Spring Harbor Laboratory Press, New York, USA 2001 Rosypal S vod do Molekulrn Biologie dl tvrt tet vydn, Prof.RNDr. Stanislav Rosypal, DrSc, Brno 2002 Brown TA; peklad Fellner M a kol. Klonovn gen a analza DNA 1 esk vydn, Olomouc UP 2007 http://biologie.upol.cz/metody/ Centraln dogma DNA

RNA Protein DNA do DNA REPLIKACE Fenotyp DNA do RNA TRANSKRIPCE RNA do Protein TRANSLACE RNA do DNA REVERZN TRANSKRIPCE Jeden gen jeden enzym (protein/polypeptid) Centraln dogma

Gen 9,200 bp 5 3 AAGCTCGACTAGCGCTAGCCTACCTAGCTCTCCCCTTCC 5 zral RNA 1,870 bp AAA 3 (kodujc sekvence ORF (open reading frame) a nepekldan regiony 5-UTR, 3-UTR) Protein 386 aa N

C CDS 1158 bp (coding sequence) Struktura genu Introny a Exony Promotor Enhancer a Silencer Potek transkripce Transkripn faktory

Signln sekvence Introny a Exony: Kodujc sekvence (ORF) mnoha eukaryotickch gen je peruen sekvenc znmou jako introny. Introny jsou seky DNA jejich transkripty nejsou ptomn ve zral mRNA. Exony jsou sti sekvence ptomn ve zral mRNA a koduj produkt eukaryotickho genu. Msto potku transkripce: msto kde zan syntza mRNA (pozice 0, 30bp od TATA boxu) . Promotor: Oblast genu (5-konec) upstream od msta potku transkripce slouc jako templt pro navzn transkripn jednotky a iniciaci transkripce. Inducibiln promotor je zvisl na ptomnosti induktoru (nzkomolekulrn ltka). Konstitutivn promotor nezvisl (provozn house keeping geny). Enhancer: st sekvence genu kter interaguje s transkripnmi faktory a tak zvyuje innost transkripce. Je umstna upstream nebo downstream od kdujc sekvence a me bt stovky bz daleko od kdujc sekvence kterou kontroluje. Silencer: Opak enhanceru. Transkripn faktory: Proteiny interagujc se specifickou sekvenci DNA,

vtinou ovlivujc terciln strukturu DNA a tak reguluj transkripn jednotku. Jsou bu aktivtory nebo represory viz ve. Koaktivtory: Proteiny interagujc s transkripnmi faktory (ale ne s DNA) regulujc transkripci. Signln sekvence: kduje signln peptid, kter peduruje zaclen proteinu na bunn rovni a nsledn se odtpuje. DNA DNA DNA polymerasy ble pednka techniky PCR DNA RNA Transkripce (RNA syntza): penos informace z DNA do RNA (nestabiln) prostednictvm enzymu RNA Polymerasy (DNA-dependentn RNA Polymerasa). Syntza RNA je komplementrn k templtovmu DNA duplexu a je identick s netempltovm vlknem duplexu (5-3). Netempltov etzec je proto nazvn kdujc etzec a je identick s mRNA s

vjimkou zmny U za T. Typy RNA: messenger RNA (mRNA, polyA+ RNA). RNA kter je pepisovna do polypeptid (1-5%). (1-5%) ribozomln RNA (rRNA). strukturn sloka ribozm. (90%) transferov RNA (tRNA). penae aminokyselin do msta syntzy proteinu. (5-10%) ml jadern, jadrkov, cytoplazmatick RNA (snRNA/sno/scRNA). sestih mRNA Postranskripn pravy mRNA epika (capping). modifikovan guanozin (m7G) je pidvn na 5'-konec vtiny mRNA. Stabilita mRNA a podl se na vazb k ribozomu. Polyadenylace. 100-200 bp dlouh sekvence polyadenozinu je pidvna na 3'-konec vtiny

eukaryotick pre-mRNA. PolyA konec nen kodovn v DNA. Sestih intron a exon. introny jsou vytpeny a exony spojeny dohromady ve struktue zvan spliceozom. Y pyrimidinov bze Postranskripn pravy mRNA RNA protein Translace (syntza protein): Translace je proces pemny informace z RNA do aminokyselinovho etzce (polypeptidu) probhajc v cytoplasm. Zral mRNA je transportovna do cytoplasmy k ribozomm (mnohdy vzan na endoplasmatickou retikulrn s). Ribozm se skld ze strukturn rRNA a 80 rznch protein, kter tvo malou a velkou podjednotku. Iniciace: Zachycen mRNA a nalezen start kodonu AUG, kter koduje methionin.

(M je odtpen bhem postranslanch prav nebo spolen se signlnm peptidem) Elongace: Pidvn rznch AK v aktivovan form vzan na tRNA a vytven peptidov vazby mezi amino a karboxylovou skupinou. Terminace: STOP kodn (UAA, UAG nebo UGA) Posttranslan pravy: Fosforylace, glykosylace, organelov clen a odtpen signlnho peptidu, sloen do aktivnho stavu (vytvoen terciln a kvartrn struktury). RNA DNA Reverzn transkripce: Proces vytvoen DNA z RNA templtu za pomoc RNA-dependentn DNA polymerasy Reverzn transkriptasa (RT). RT je ptomn pouze v RNA virech avian myeloblastosis virus (AMV), AMV Moloney murine leukemia virus (MMLV), MMLV nebo human immunodeficiency virus (HIV).

Aplikace: tvorba cDNA (komplementrn DNA): pesn DNA kopie mRNA. DNA sekvence proteinu bez peruen introny. cDNA knihovny RT PCR Hybridizace Dva etzce DNA mohou bt k sob komplementrn. mRNA syntetizovna z genu je identick k jednomu vlknu svho genu a komplementrn k druhmu vlknu. Komplementrn etzce mohou bt oddleny (denaturace) a znovu spojeny (renaturace hybridizace) na rznm stupni specifity, mohou vznikat hybridn formace DNA-DNA, DNA-RNA, nebo RNARNA. Methody vyuvajc tchto vlastnosti: Southern blot: Hybridizace DNA na DNA (v pevn fzi) Northern blot: Hybridizace DNA na RNA (v pevn fzi) RNAse protection assay: Hybridizace RNA na RNA (v roztoku) In situ hybridizace DNA-DNA nebo DNA-RNA (ve tkn, i v buce,

nap. FISH) izolace mRNA: vazba polyA konce na polyT sekvenci navzanou na pevn matrix. Stringence: podmnky zaruujc stupe specifity (komplementarity) Strigence hybridizace teplota koncentrace soli Denaturan inidla (formamid) za snen teploty udruj vysokou strigenci Princip Southern a Northern blotu Hybridizan sondy jsou znaen:

chemiluminiscenn BIOTIN detekce AVIDIN-HRP, DIGOXYGENIN fluorescenn FLUORESCEIN, RHODAMIN radioaktivn dAT32P, 3H Pprava sond: 5 a 3koncov znaen nzk citlivost pomoc RANDOM HEXAMER a DNA polymerasy (Klenowv fragment) PCR nick translace DNasa I a DNA polymerasa in vitro transkripce (RNA prby) FISH fluorescent in situ hybridization pklad nukleotidu znaenho digoxygeninem

Pprava hybridizanch sond znaen pomoc nhodnch hexameru znaen pomoc nick translation (posun jednoetzcovho zlomu) RESTRIKN ENDONUKLEASY (restrikn enzymy II tdy) rozpoznvaj specifick sekvence dsDNA a tpou j ve stejnm mst rozpoznvac msto je 4-8 bp dlouh

tpou dlouh fragmenty dsDNA na krat tpou vdy znovu opakovatelnm zpsobem pochzej pedevm z bakteri ochrana ped cizorodou DNA pedevm bakteriofgovou

modifikan-restrikn enzymov systm (RE + specifick modifikan metylasa) Pes 120 rozpoznvacch mst dodnes popsanch vce ne 800 RE RESTRIKN MSTA MAJ BOD SYMETRIE RE mohou na DNA vytvet TUP nebo LEPIV konce restrikn sekvence jsou vtinou symetrick.

nukleotidy vytvej PALINDROM Palindrom: sekvence se te stejn v obou smrech jak ve 5 3 tak ve smru 5 3 na komplementrnm etzci. EcoRI TUP KONCE nespecifick spojen LEPiV KONCE specifick spojen Existuj RE se stejnou restrikn sekvenc lic se pouze typem vzniklch konc (5- i 3- lepiv) KpnI vs. Asp718 - izoschizomery Lepiv konce: kad DNA fragment (jakhokoli pvodu) tvo tpenm stejnou RE dv jednovlknov identick sekvence (ten ve smru 5 - 3). Kompatibiln konce: BamHI

GGATCC BglII AGATCT dv odlin DNA majc stejn rozpoznvac msto pro danou RE se mohou vzjemn spojit v rekombinantn DNA molekulu rekombinantn DNA molekula: je nov kombinace nukleotid v DNA kter se nevyskytuje voln v prod Poet nukleotid v restriknm mst dan RE determinuje prmrnou dlku fragment DNA zskanch natpanm danou RE Pravdpodobnost e dan restrikn msto bude nalezeno v genomu: 1) 44 = 256 bp 2) 46 = 4096 bp 3) 48 = 64 000 bp prmrn vzdlenost mezi

restriknmi sekvencemi v DNA = 4n n = # bz v restriknm mst Psoben RE je velmi citliv na iontovou slu roztoku a charakter ptomnch sol. Pokud nejsou zachovny specifick podmnky pro danou RE ta me mt tzv. star aktivitu STAR AKTIVITA nespecifick nhodn tpen GTAC T4 DNA ligasa

enzym izolovan z T4 bakteriofga infikujcho E.coli, katalyzuje tvorbu fosfodiesterov vazby mezi 5 fosftovou skupinou jednoho a 3OH skupinou sousednho nukleotidu. reakce vyaduje energii jednoho ATP pouv se ke spojovn lepivch i tupch konc dvou restriknch fragment DNA, pipojovn rznch adaptorovch sekvenc k DNA a cirkulizaci DNA Reakce se provd vtinou za snen teploty (1516C) aby se snila kinetick energie molekul a zabrnilo se tak nekomplementrnmu sprovn lepivch konc. zpor: nzk aktivita enzymu dlouh reakn as.

Dal enzymy pouvan v molekulrn biologii: Alkalick fosfatasa Mung Bean nukleasa KLONOVN Molekulrn klonovn: multi-krokov proces kter vytvo kolekci definovanch fragment dan DNA pomoc restriknch endonukleas spojen vybranch DNA fragment (vtinou jednoho genu) se specilnm nosiem vektor pomoc T4 DNA ligasy penos vzniklho konstruktu do ivch bunk (asto baktrie) mnohonsobn namnoen vloench DNA fragment replikaci v iv buce DNA KLONY Bunn klonovn: vytven geneticky identickch bunk (organism) v iv prod pirozen: kolonie baktrii

zkovn rostlin jednovajen dvojata uml KLONOVAC VEKTORY A) Bakteriln a kvasinkov PLASMIDY - pirozen soust bakterilnch bunk nesouc vlastn genetickou informaci ve form dsDNA (rezistence k antibiotikm, metabolismus nezvyklch substrt) 1-100kb replikuj se nezvisle na baktrii vlastn plasmidov vektory vznikly pravou pirozench high copy plasmidy -

1970 - pBR (Bolivar a Rodriguez) - 4.36 kb men ne je pirozen se vyskytujc v E.coli - ori vlastn potek replikace - rezistence k Amp a Tc - uniktn restrikn msta - kapacita pro inzertovou DNA 1-5 kb 100-1000 kopi v buce MCS multiple cloning site (polylinker) ori KLONOVAC VEKTORY B)

Virov - BAKTERIOFGY - bakteriln viry s dvouetzcovou linern DNA klonovac kapacita 2-25kb inzertu - mnohonsobn mnoen v zvislosti na hostitelsk bakterii cos cos BAKTERIOFG lambda 49kb

Stedn st genomu nen dleit pro lytick rst a lze ji nahradit inzertovou DNA snadn manipulace dky cos mstm (lepiv konce) na koncch DNA, kter umouj jej cirkulaci Zacirkuluje se pouze bakteriofg, kter m vzdlenost mezi cos msty 37-52kb tvorba cDNA a genomovch knihoven

KLONOVAC VEKTORY C) bakteriln-virov - KOSMIDY odvozen z plasmidu do kterho byly naklonovny cos msta bakteriofga Inzertov DNA je naklonovna do linernho kosmidu a sbalena in vitro virovm mechanismem a infikovna do bakterie v bakterii je pak cirkulovna a replikuje se dl jako plasmid mal velikost cca 5kb nen poteba infeknch lytickch protein, pouze selekn marker k antibiotiku, velikost inzertov DNA se me pohybovat a k 47kb D) bakteriln-virov - FASMIDY (phagemid)

odvozen od bakteriofga M13 s malou ssDNA (6.4kb), kter se po infekci do bakterie replikuje jako kruhovit dsDNA (plasmid, snadn manipulace, restrikce) infekn fgov stice vak opt obsahuj pouze ssDNA (vhodn zdroj pro izolaci ssDNA nap. pro hybridizaci) do infeknch stic mohou bt sbaleny stice a dvakrt vt ne je fgov DNA KLONOVAC VEKTORY E) kvasinkov - YAC uml kvasinkov chromosomy (yeast artificial chromosomes) pat mezi kyvadlov vektory (shuttle vector) v bakterii jako kruhov dsDNA (plasmid) vedle sekvenc bakterilnho plasmidu obsahuj sti kvasinkovho chromozomu (centromera, potek

replikace,dv telomery) linearizac se chromozom aktivuje (oddlen telomer od sebe) obrovsk klonovac kapacita a 2000kb nestabilita a sloit manipulace (protoplasty) KYVADLOV VEKTORY umoujc existenci a replikaci ve dvou rozdlnch organismech: pYES bakterie kvasinka - potek replikace z pirozenho kvasinkovho vektoru 2 Ti-plazmid bakterie rostlina viz pednka transgenoze rostlin KLONOVAC VEKTORY F) bakteriln - BAC uml bakteriln chromosomy (bacterial artificial chromosomes) Odvozen od E.coli F-plasmidu (fertility plasmid), low copy 1-2 kopie na buku

VHODY oproti YAC: - stabilita (cirkulrn) - snadn manipulace - potlaen rekombinace Vhodn fragmenty genomick DNA pro ligaci jsou zskny pulsn gelovou elektroforesou INVITROGEN VELK VZNAM PI MANIPULACI S CELMI GENOMY Obecn princip molekulrnho klonovn klonovac vector + DNA obsahujc poadovan gen (izolace) restrikce ligace

transformace selekce pomoc seleknch marker reprodukce a syntza clovho proteinu izolace Vyuit molekulrnho klonovn uchovvn, zmnoen a manipulace s genetickou informac (cDNA a genomov knihovny) produkce protein pro rznorod vyuit vnen novch i pozmnnch gen do organism (GMO, genov terapie) farmaceutika

zemdlstv zkladn vzkum prmysl medicna SELEKN MARKERY geny nesen na klonovacm vektoru, exprimovan souasn s transgenem, na jejich fenotypovm projevu lze transformovan buky snadno selektovat 1) geny kdujc degradaci ANTIBIOTIKA INHIBITORY SYNTZY BAKTERILN BUNN STNY AMPICILIN gen Amp koduje -laktamasu kter tp -laktmov kruh penicilinovch antibiotik

CEFOTAXIM INHIBITORY SYNTZY PROTEIN CHLORAMFENIKOL, KANAMYCIN (vou se na ribozomln podjednotky) gen Cml kduje chloramfenikol acyltransferasu gen Kan kduje aminoglykosid fosfotransferasu AMPICILIN SELEKN MARKERY 1) geny kdujc degradaci ANTIBIOTIKA INHIBITORY SYNTZY PROTEIN

TETRACYKLIN (zabrauje vazb aminoacyl tRNA k ribozomu) gen Tet kduje membrnov protein, kter aktivn transportuje TC ven z buky HYGROMYCIN B (interferuje s velkou ribozomln podjednotkou a zabrauje elongaci syntetizovanho peptidu) gen zpsobujc rezistenci hgh kduje fosforylasu inaktivujc toto antibiotikum. PSOB I NA EUKARYOTICK BUKY!!! (selekce transgennch rostlin) INHIBITORY TRANSKRIPCE A REPLIKACE ACTINOMYCIN D (inhibuje transkripci tm, e se ve na specifick seky DNA) RIFAMPICIN (inhibuje prokaryotn RNA polymerasu, ale i chloroplastovou a mitochondriln, proto je toxicky i pro lovka) ZEOCIN glykopeptid izolovan ze Streptomyces, kter tp po vstupu do buky jakoukoliv DNA. Rezistentn gen Sh ble kduje inhibin protein (13.6 kDa) tohoto glykopeptidu.

koncentrace inn pro selekci: Baktrie 25-50 g/mL Kvasinky 50-300 g/mL Sav buky 50-1000 g/mL ZEOCIN SELEKN MARKERY 2) geny kdujc enzymy naruujc NUTRIN NEDOSTATENOST (ztrta autotrofie) - pouvaj se pedevm pro selekci transgennch kvasinek Gen URA3 kduje enzym orotidin 5-fosft dekarboxylasu, enzym metabolick drhy uracilu

LYS2 kduje aminoadipt reduktasu (bisyntza lyzinu) ADE2 (C1-tetrahydrofolt syntasa), LEU2 (- izopropylmalt dehydrogenasa), TRP1 (fosforibozylanthranilt izomerasa) Princip selekce: pro transformaci danho plasmidu se pouij specifick kmeny kvasinek deficientn pro dan gen, selekce se pak provd na minimlnm mdiu (bez ivin). Pklad: kmen Saccharomyces cerevisiae INVSc1 genotyp: MATa his31 leu2 trp1-289 ura3-52 /MAT his31 leu2 trp1-289 ura3-52 fenotyp: His-, Leu-, Trp-, Uratzn. e tento kmen je autotrofn na histidin, leucin, tryptofan a uracil a na mdiu bez tchto ivin neporoste

kyvadlov vektor pro transformaci kvasinek SELEKN MARKERY 3) blue/white screening test - pomocn test pro selekci transformovanch bakteri i bakteriofgu klonovac vektor nese gen lacZ+ kter kduje enzym -galaktosidasu (tp laktosu na galaktosu a glukosu) MCS je umstn uvnit tohoto genu, a po vloen inzertu se tento gen stv neaktivn X-GAL HOCH2 O

O HO H O Cl Br OH galaktosa N H modr barvivo Ampicilin (zabije netransformovan bakterie) X-GAL (5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside)

uml substrt IPTG (isopropyl-1-thio--D-galaktopyranoside) induktor exprese lacZ genu lytick a lysogenn cyklus vir struktura lambda bakteriofga SELEKN MARKERY 4) lysogenn selekce bakteriofgovch vektoru LAMBDA FIX II VEKTOR ( bakteriofgov vektor) -

- - red/gam+ selekce se provd na specilnm kmeni E.coli (lysogenn pro P2 bakteriofga, tzn. e hostitelsk buka je ji napaden jinm bakteriofgem) Pokud m vektor genotyp red/gam+ na danm kmeni neroste je tzv. Sensitivn k P2 interferenci (Spi+ fenotyp) 12 kb

red/gam- red a gam geny se nachzej ve stedn sti (stuffer) a jsou nahrazeny inzertem. Bakteriofg s inzertem je tudi Spi- a me bt vyselektovn na P2 lysogennm kmeni pli mal nesbal se do kapsidy inzert (genomov knihovna)

Recently Viewed Presentations

  • GIS APPLICATION - etiuppcl.org

    GIS APPLICATION - etiuppcl.org

    This functionality is used to calculate the LT/HT and Total Length of feeder (in meters) based upon Division/Town. 7.Manage Document. This Functionality is used to manage the Document associated with target layer within the GIS Map.
  • Vocabulary

    Vocabulary

    Vocabulary Unit 1-Context Clues What are the expecations? I will give you a vocabulary word or term and you will write down the definition Most of the time I will say to write a sentence using the word Notes will...
  • Chapter 10

    Chapter 10

    Divers know that the pressure exerted by the water increases about 100 kPa with every 10.2 m of depth. This means that at 10.2 m below the surface, the pressure is 201 kPa; at 20.4 m, the pressure is 301...
  • İdiopatik Hiperkalsiüri

    İdiopatik Hiperkalsiüri

    Calcium-Sensing Receptor Mutasyonu ve Hiperkalsiüri CASR proteini paratiroid bezde, ayrıca belirli tubulüs bölgelerinde, kemikte, gastrointestinal sistemde ve tiroidde kalsitonin-salgılayan C hücrelerinde bulunur. ... (FHH) olur. Aksine ayar azalırsa yani sensör çok daha hassas hale ...
  • FMGT 1100 Accounting Level 1 - O.P.M.T. BCIT

    FMGT 1100 Accounting Level 1 - O.P.M.T. BCIT

    Tracy Oh (The most awesome accounting instructor) has provided us with 10 practice multiple choice questions from each chapter. Here is how to access it: Go to shareout. Click on FMGT1100. Click on Traceyoh. Download Finalpractice folder to your computer....
  • Voices for Healthy Kids: Helping All Children Grow

    Voices for Healthy Kids: Helping All Children Grow

    Today. Intro to Voices for Healthy Kids. Junk Food Marketing . work across the states. Campaign Resources. My role here today is to provide a brief overview of Voices for Healthy Kids, including our policy priorities and work on Junk...
  • DNA: Structure and Functions

    DNA: Structure and Functions

    Thus there was some material in the heat-killed S strain that was responsible for "transforming" the R strain into a lethal form. Transformation Taking up of extraneous genetic material from the environment by bacteria Avery, MacLeod and McCarty Produced paper...
  • Abduction: The logic of discovery - Creative Wisdom

    Abduction: The logic of discovery - Creative Wisdom

    Black swan vs. elephant in the room ... It is like that you interviewed ten girls selected from e-harmony or Christian Mingle, and then you pick the best one to be your bride. ... talking to professor, teachers, parents, and...