Presentation #5 First Gene Sequencing Methods

Presentation #5 First Gene Sequencing Methods

First Sequencing Methods Sebastian Beuchelt BIOL 446 Dr. Adema, Dr. Natvig 23 Sep 2019 Big Ideas DNA hereditary material written in nucleotides. Sequencing "reading" Reverse genetics modern basis for knowledge of genome organization. Earliest form of nucleotide sequencing RNA sequencing

Why Sequence? Altered or non-functional protein. Harmful, neutral, or positive effects. Understanding genetic conditions. Treatments. Sequencing: DNA vs. Gene vs. Genome Sequencing: DNA vs. Gene vs. Genome DNA DNA chain of nucleic acid. A, T, C, and G. DNA sequencing determination of

the order of the nucleotides in an individuals DNA. Gene Gene distinct portion of the DNA that codes for a protein or RNA. Gene sequencing determination of the order of the nucleotides in an individual gene. ***not all DNA sequences are genes (i.e. coding regions, promoters, tandem repeats, introns, etc.) depending on organism and source of the DNA sample. Sequencing: DNA vs. Gene vs. Genome Genome Genome complete set of genes.

Genome sequencing determination of the order of the nucleotides in an individuals entire genetic material. Genomics sequencing and determining function of proteins, genes, and metabolic pathways in an organism. First Sequencing Methods Lots of Ways of Sequencing Early RNA sequencing Dye-terminator sequencing Wandering spot analysis

Capillary electrophoresis Chemical cleavage method Pyrosequencing* Chain termination method* Sequencing by ligation Cycle sequencing* Sequencing by hybridization* High-throughput sequencing* Next generation sequencing*

* still used today techniques, not strictly sequencing methods Early RNA Sequencing Insulin First complete protein sequeced Fredrick Sanger (1955) Bacteriophage MS2 ((+)ssRNA) First complete gene/genome sequenced Walter Fiers et al. (1972) Read RNA nucleotides by matching with amino acid sequences RNA = smaller than DNA

Basis for RNA-sequencing Early RNA Sequencing PROS: o First form of sequencing. o Revolutionary ideas. CONS: o Poor results.

o Lots of work. o Difficulty scaling to genomes. o Uses RNA and amino acids rather than DNA. Wandering Spot Analysis Walter Maxam and Allan Gilbert (1973)

lac Repressor First DNA sequenced reported sequence of a whopping 24 base pairs 5--T G G A A T T G T G A G C G G A T A A C A A T T--3 3--A C C T T A A C A C T C G C C T A T T G T T A A--5 Wandering Spot Analysis dsDNA fragments denatured into ssDNA fragments by heat. Radioactive (32P) label to 5' end of DNA fragments

with kinase reaction. Cleave DNA strand at random nucleotides using snake venom. DNA fragments applied to cellulose acetate strip and differently sized DNA strand fragments separated by size in electric field. Fragments ending with G & T move to cathode Fragments ending with C & A move to anode Longest spots are connected to next longest and so on, indicating increasing number of nucleotides. Wandering Spot Analysis PROS: o

Used DNA rather than RNA. o Higher accuracy. CONS: o Poor results. o Lots of work. o

Difficulty scaling to genomes. o Requires X-rays and radiolabeling. Chemical Cleavage Method Maxam and Gilbert (1977) Similar to Wandering Spot Analysis. Allowed for at least 100 bases. lac Operator 5--G G C A C G A C A G G T T T C C C G A CTGGAAAGCGGGCAGTGAGC GCAACGCAATTAATGTGAGTT AGGACCGTGCTGTCCAAAGG GCTGACCTTTCGCCCGTCACT

CGCGTTGCGTTAATTACACTC A A--3' Chemical Cleavage Method dsDNA fragments denatured into ssDNA fragments by heat. Radioactive (32P) label to 5' end of DNA fragments with kinase reaction. Cleave DNA strand at specific nucleotides using specific chemicals. (G>A, A>G, C, and C+T in four reaction tubes). Differently sized DNA strand fragments separated by size via electrophoresis. Fragments are found by means of autoradiographic detection of locations of radioactivity in form of dark spot. Fragments ordered by size determine the sequence

of the DNA molecule. Chemical Cleavage Method PROS: o Was more popular than Sanger sequencing. o Purified DNA could be used directly. (dsDNA) CONS:

o Lots of work. o Difficulty scaling to genomes. o Requires X-rays and radiolabeling. Chain Termination Method Sanger et al. (1977) Precursor to modern Sanger Sequencing (cycle sequencing)

Bacteriophage X174X174 First complete DNA genome sequenced Chain Termination Method The dsDNA fragment is denatured into ssDNA fragments by heat. ssDNA is multiplied into millions of copies. Primer that corresponds to each fragment is attached. Fragments are added to four polymerase solutions, each solution containing the four types of dNTPs but only one type of ddNTP. Chain elongated until a termination nucleotide is randomly added. Resulting dsDNA fragments are denatured to obtain a series of ssDNA of various lengths.

Fragments are separated by electrophoresis and termination dyed sequence is read. Chain Termination Method PROS: o PCR errors overcome. o Long sequences (~450 bp) CONS o

Only 1 sequence at a time o Requires lots of DNA o Expensive o 2/base Fun Fact 1973 cost/bp = $10,000+

2019 cost/bp = $0.000000014 1973 cost/genome = $64,000,000,000,000+ 2019 cost/genome = $1,301 References https://www.britannica.com/science/DNA-sequencing https://binf.snipcademy.com/lessons/dna-sequencing-techniques/ maxam-gilbert https://www.nature.com/scitable/topicpage/dna-sequencing-tech nologies-690/ http://symposium.cshlp.org/content/18/123

https://www.nature.com/articles/nrg2934 https://www.pnas.org/content/70/12/3581 https://www.ncbi.nlm.nih.gov/gene?Db=gene&Cmd=DetailsSear ch&Term=3630 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC427284/pdf/pnas 00139-0311.pdf http://cdn.intechopen.com/pdfs/35675/intech-dna_representatio n.pdf https://www.ncbi.nlm.nih.gov/pmc/articles/PMC431765/ https://www.genome.gov/about-genomics/fact-sheets/DNA-Sequenc ing-Costs-Data

https://www.veritasgenetics.com/our-thinking/whole-story https://www.researchgate.net/figure/The-Sanger-sequencing-metho d-in-7-steps-1-The-dsDNA-fragment-is-denatured-into-two_fig2_234 248746 https://www.genscript.com/molecular-biology-glossary/1381/homoc hromatography https://www.genetics.org/content/162/2/527.figures-only https://www.ncbi.nlm.nih.gov/pubmed/14933251 https://www.ncbi.nlm.nih.gov/pubmed/13580867?dopt=Abstract https://academictree.org/chemistry/publications.php?pid=4333 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC392330/pdf/pnas http://www.bioscirep.org/content/24/4-5/237 00024-0174.pdf https://www.sigmaaldrich.com/technical-documents/articles/biology https://science.sciencemag.org/content/291/5507/1195 /sanger-sequencing.html

https://www.promegaconnections.com/tag/chain-termination-me http://biomodel.uah.es/metab/expresion/operon_Lac.en.htm thod/ https://www.semanticscholar.org/paper/Advanced-Methods-in-Protei https://www.ncbi.nlm.nih.gov/pmc/articles/PMC431765/pdf/pnas n-Microsequence-Analysis-Wittmann-Liebold-Salnikow/5b52f7ff3e1 00043-0271.pdf Questions? [email protected]

Recently Viewed Presentations

  • ETS Air Data Administration Module Training Manual for Industry

    ETS Air Data Administration Module Training Manual for Industry

    Industry Administration Screen. This is the "Industry Administration" Screen.At the top of the screen in the blue band are 2 choices: " Station Maintenance " - the Station Manager maintains information on the stations
  • Halogenverbindungen - Philipps-Universität Marburg

    Halogenverbindungen - Philipps-Universität Marburg

    Epidemiologische Untersuchungen an DDT-exponierten Arbeitern schätzen, daß eine Induktion des Metabolismus der Leber ab einer Zufuhr von 0,25 mg/kg KG × Tag einsetzt. 2001 Südafrika beginnt nach der Malaria-Epidemie von 1999/2000 wieder mit dem Einsatz von DDT.
  • TYPOGRAPHY - College Station Independent School District

    TYPOGRAPHY - College Station Independent School District

    Justified type results in irregular spacing between words, or between words and letters. It usually results in "rivers" of white space. BOTH impede legibility. Justified type results in irregular spacing . between words, or between words and letters. It also...
  • Title

    Title

    Nepal. Flag. Weather. Language. Population. Nepali is the official language, but the are 20 other languages spoken! 27.47 million people live in Nepal! The weather in Nepal varies a lot; from monsoon rains, to freezing temperatures in the winter to...
  • The "Magic F.I.T."

    The "Magic F.I.T."

    The Master F.I.T.™ How to Avoid Being a Square Peg in a Round Hole! Presented by: Trish Dervin, CCMC Career Conversions, LLC ©Career Coach Academy *
  • Using desmos.com to Engage Students in Discovery Learning

    Using desmos.com to Engage Students in Discovery Learning

    Regression. Extrema of polynomials. The Basics. ... Students can model the weather using sinusoidal waves. Modeling Using Sinusoidal Waves Activity- (Included in your packet) ... Using desmos.com to Engage Students in Discovery Learning
  • Pin Attire! - Sigma Alpha Iota

    Pin Attire! - Sigma Alpha Iota

    SAI Badge Attire! Created by Brittni Kelly, Iota Theta Chapter Edited by Dr. Deborah R. Volker, NVPRFE No Jeans! …these are still jeans… No denim! Not even black or dark!!! Skirts and Dresses! These are ok… These are not. Badges...
  • What Is Persuasion?

    What Is Persuasion?

    What Is Persuasion? Persuasion is a "symbolic process in which communicators try to convince other people to change their attitudes or behaviors regarding an issue through the transmission of a message in an atmosphere of free choice."-- Richard M. Perloff....